The First Symbiont-Free Genome Sequence of Marine Red Alga, Susabi-nori (Pyropia yezoensis)

نویسندگان

  • Yoji Nakamura
  • Naobumi Sasaki
  • Masahiro Kobayashi
  • Nobuhiko Ojima
  • Motoshige Yasuike
  • Yuya Shigenobu
  • Masataka Satomi
  • Yoshiya Fukuma
  • Koji Shiwaku
  • Atsumi Tsujimoto
  • Takanori Kobayashi
  • Ichiro Nakayama
  • Fuminari Ito
  • Kazuhiro Nakajima
  • Motohiko Sano
  • Tokio Wada
  • Satoru Kuhara
  • Kiyoshi Inouye
  • Takashi Gojobori
  • Kazuho Ikeo
چکیده

Nori, a marine red alga, is one of the most profitable mariculture crops in the world. However, the biological properties of this macroalga are poorly understood at the molecular level. In this study, we determined the draft genome sequence of susabi-nori (Pyropia yezoensis) using next-generation sequencing platforms. For sequencing, thalli of P. yezoensis were washed to remove bacteria attached on the cell surface and enzymatically prepared as purified protoplasts. The assembled contig size of the P. yezoensis nuclear genome was approximately 43 megabases (Mb), which is an order of magnitude smaller than the previously estimated genome size. A total of 10,327 gene models were predicted and about 60% of the genes validated lack introns and the other genes have shorter introns compared to large-genome algae, which is consistent with the compact size of the P. yezoensis genome. A sequence homology search showed that 3,611 genes (35%) are functionally unknown and only 2,069 gene groups are in common with those of the unicellular red alga, Cyanidioschyzon merolae. As color trait determinants of red algae, light-harvesting genes involved in the phycobilisome were predicted from the P. yezoensis nuclear genome. In particular, we found a second homolog of phycobilisome-degradation gene, which is usually chloroplast-encoded, possibly providing a novel target for color fading of susabi-nori in aquaculture. These findings shed light on unexplained features of macroalgal genes and genomes, and suggest that the genome of P. yezoensis is a promising model genome of marine red algae.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Generation of 10,154 expressed sequence tags from a leafy gametophyte of a marine red alga, Porphyra yezoensis.

A total of 10,154 5'-end expressed sequence tags (EST) were established from the normalized and size-selected cDNA libraries of a marine red alga, Porphyra yezoensis. Among the ESTs, 2140 were unique species, and the remaining 8014 were grouped into 1127 species. Database search of the 3267 non-redundant ESTs by BLAST algorithm showed that the sequences of 1080 species (33.1%) have similarity t...

متن کامل

Complete Sequence and Analysis of Plastid Genomes of Two Economically Important Red Algae: Pyropia haitanensis and Pyropia yezoensis

BACKGROUND Pyropia haitanensis and P. yezoensis are two economically important marine crops that are also considered to be research models to study the physiological ecology of intertidal seaweed communities, evolutionary biology of plastids, and the origins of sexual reproduction. This plastid genome information will facilitate study of breeding, population genetics and phylogenetics. PRINCI...

متن کامل

Characterization of an Eukaryotic PL-7 Alginate Lyase in the Marine Red Alga Pyropia yezoensis

BACKGROUND Alginate lyases belonging to polysaccharide lyase family-7 (PL-7) are the most well studied on their structures and functions among whole alginate lyases. However, all characterized PL-7 alginate lyases are from prokaryotic bacteria cells. Here we report the first identification of eukaryotic PL-7 alginate lyase from marine red alga Pyropia yezoensis. METHODS The cDNA encoding an a...

متن کامل

Chloroplast-encoded serotonin N-acetyltransferase in the red alga Pyropia yezoensis: gene transition to the nucleus from chloroplasts

Melatonin biosynthesis involves the N-acetylation of arylalkylamines such as serotonin, which is catalysed by serotonin N-acetyltransferase (SNAT), the penultimate enzyme of melatonin biosynthesis in both animals and plants. Here, we report the functional characterization of a putative N-acetyltransferase gene in the chloroplast genome of the alga laver (Pyropia yezoensis, formerly known as Por...

متن کامل

The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:

دوره 8  شماره 

صفحات  -

تاریخ انتشار 2013